SF Cell Structure and Function

This was my first ever college biology module. It was taught across five weeks, one topic per week, but because it was taught with a flipped classroom it was more like we had about 8 lectures a week than 4 so it was like cramming a semester-long course into half that time. For the flipped classroom, we'd be assigned lectures to watch on Blackboard and quizzes to do (up to 3 quizzes and online lecturs per actual lecture) before the actual lecture, with the quizzes going towards our Continuous Assessment marks. I usually got 100% on the (short) quizzes, which was confidence-boosting for my first bio module having jumped into the course in second year. So that was nice and it made sure I stayed on track, but it was definitely a huge amount of work and felt like a way to cram tons more material in (as they wouldn't repeat themselves in the physical lectures). 

LECTURES

Week 1: Eukaryotic Cell Structure and Function

• Cell Structure/Organelles (very briefly)
• Vesicular Trafficking (how things are trafficked in and out of the nucleus, mitochondria and ER and Golgi e.g. using Nuclear Localization Sequences to get into the nucleus, being unfolded to get into the mitochondrion)
• DNA and RNA processes like transcription, translation
• Cytoskeleton (actin, microtubules, intermediate filaments dynamics and diseases)

Week 2: Proteins

• importance of proteins to the body and as drugs
• the 20 major amino acids, their structures and properties, isoelectric point
• protein folding e.g. Anfinsen's RNase experiments, hydrophobic collapse, levels of organisation, and analytic biochemistry e.g. gel electrophoresis and lots of other methods
• we were supposed to have a 4th lecture, on haemoglobin, but this didn't go ahead

Week 3: Enzyme Kinetics

Most of the actual exam material was taught in the online lectures, which were mostly just maths: 

• deriving the Michaelis-Menten equation using Rapid Equilibrium assumption and Steady State assumption (these were difficult at first but I grew to love them just before the exam and I really wish they had come up because they're absolutely fine once you know them)
• reversible enzyme inhibition (competitive, uncompetitive, noncompetitive/mixed with their rate equations and a bunch of different graphs for them)

In the physical lectures we had a nice demo of why e.g. adding more substrate usually doesn't speed up the rate of an enzymatic reaction, because it's the enzyme that's limiting, and he talked about the theory behind enzymology and measuring reaction rates, and also about allosteric enzymes and regulation with things like concerted and sequential models of going between Tense/Relaxed states, and a bit about medicine since many drugs are enzyme inhibitors, so things like kinase inhibitors and the problems of lack of specificity and resistance, and HMG-CoA reductase inhibitors.

Week 4: Neurochemistry

This course was very intimidating because oh boy neuroscientists love their jargon and anatomy and that is not my thing. I did like the neurotransmitter synthesis bit though, that was some interesting biochemistry. But damn the dude gave an absolutely insane amount of detail and seemed to expect us to know a lot, since he said he would only give a first to someone who put extra reading into their essays after he was already asking a lot ... but I think he may have been just saying that because I ended up having to answer his question on a Schols paper and I got Schols (admittedly my other essay on that paper was possibly the best I've ever written so that did a lot of the heavy lifting). 

The bulk of his info was in the online lectures as well, and I am annoyed that he had an ambiguous question in one of his quizzes that caused me to lose marks (I think it was that he said cytoplasm instead of cytosol or something, and being literal-minded I thought 'well technically it IS in the cytoplasm since everything is' and I didn't know if it was a trick question or just poorly phrased). I brought it up with him and he was like 'well it's not many marks anyway' but that's easy for a lecturer to say when they're not relying on marks to get them into a good course.

• cell types and structures of the brain - neurons, glia, astrocytes, myelin, etc
• synthesis of neurotransmitters including dopamine, noradrenaline, serotonin. 
• action potentials, Na/K pumps, calcium/calmodulin, neurotransmitter release 
• neurotransmitter reuptake, degradation and recycling (learned why meth is bad for you)
• diseases like Parkinson's and why L-Dopa is given along with other drugs to let it cross the blood-brain barrier and to stop it being converted back to its precursor

Week 5: Signal Transduction

I liked this one, and I'd covered a fair bit of it over the summer from Campbell. Again most of the detail was in the online lectures, which I guess was the idea, and the physical lectures were for broader themes.

• principles of cell signalling e.g. specificity, amplification, crosstalk
• G-protein coupled receptors and their pathways e.g. B-adrenergic receptor and the phosphoinositide cascade
• Receptor tyrosine kinases and their pathways e.g. insulin and epithelial growth factor --> MAPK cascade and trafficking of GLUT4 receptor to membrane plus activation of glycogen synthase by phosphorylation of glycogen synthase kinase which inhibits it from inhibiting glycogen synthase and thus fuel is stored as glycogen.

LABS & ASSIGNMENTS

We had 3 labs, all in the Biomedical Sciences building, which was fancy. I've actually forgotten almost everything about the labs (mostly the memories have been replaced by the Metabolism labs, which were similar) so off to check Blackboard I go.

• Spectrophotometry - all I remember about this is that trying to use the spectrophotometer involved lots of repetitive movements, and that we had to keep getting new versions of the alcohol dehydrogenase enzyme because our one never worked (not even for the supervisors). We had to use the Beer-Lambert law which was fine because we'd used it in chemistry the year before and it's simple, and plot absorbance graphs like this: 

• Chromatography - we used two types of chromatography, gel filtration (size) and ion exchange (charge). The assignment for this had some nice reasoned but not too hard questions like:

 A gel filtration resin has the following technical specifications: it will exclude globular proteins with a molecular mass greater than 50,000, and will completely include globular proteins with a molecular mass less than 6,000. In what order will proteins with molecular weights of 70,000, 40,000, 4,500, and 20,000 be eluted from the column? Would this setup work for separating a mixture with proteins of weight 72,000, 90,000, 80,250 and 5000 into its component parts?

and I said that they will elute in decreasing order of weight, and that it wouldn't work for the second one because 'three of them (Proteins 5, 6, and 7) are above the top of the fractionation range and will just come out quickly and together with the mobile phase. Protein 8 is below the bottom of the range and would elute last because it can enter all of the beads. So this could work if you just wanted to isolate Protein 8 from the other three, but I don’t think it would work to separate Proteins 5, 6 and 7 from each other.' Not the hardest question, but it was nice in that it tested if you understood what the procedure did and what sort of experiments it'd be suitable for.

• Enzyme Kinetics - this involved working with enzyme inhibitors and culminated in finding the Ki of the inhibitor by graphing the slopes of the Lineweaver-Burk plot against concentration againt inhibitor. It seemed intimidating but was cool once I got it done.

COMPUTER MARKED ASSIGNMENT & NUMERICAL SKILLS TUTORIAL

The numerical skills tutorial was very very easy and kind of disappointing in how easy it was, because I finished really quickly but the class moved through the maths really slowly. A lot of it was just working with orders of magnitude so being fluent with converting between nanomoles and millimoles for example, and also working with pH. It was like LC Chemistry or Physics. 

On the bright side the CMA which was just numerical questions was then really easy and I, along with a lot of other people I think, got 100% on it. 

This was the CMA, as opposed to the Demonstrator Marked Assignment. 

PROTEOMICS PROJECT

The Proteomics project was awesome and a really cool thing to have added to the course. It was a bioinformatics project/treasure hunt where we were given a gene in a text file (just an ATGCTATCGATAGCTAGGCTAGCT or whatever sequence) and had to work out what the gene was, compare it to similar ones, and find out its functions.

We started by finding an open reading frame and getting a program to work out what the amino acids were, so methionine-leucine etc, and do a bunch more stuff including working out what the gene was (I think it was a myosin muscle gene) and comparing it to the same gene from a different species I think using sequence alignment and matching identical/similar/dissimilar amino acids, and then some questions about what that meant and evolution of the gene and how its function might have changed, and then visualising the protein the gene codes for using protein modelling software. We used lots of different tools including BLAST and ClustalW. It was a really awesome project, exactly the sort of thing I like with having enough instructions but also having a treasure hunt style and getting to think for yourself a little. 

I did like it but I found the difficulty level odd; I found the first week, especially on the cytoskeleton (actin, intermediate filaments, microtubules) and trafficking of molecules between vesicles in the cell, very difficult. It was a LOT of information and work, because of the flipped classroom way it was taught. I loved the proteomics project, the practical assignments, and a lot of the lectures. Good module (until it was swamped by even better modules (I wrote that as molecules originally)!).